Journal: Cell reports

Article Title: Aging disrupts sympathetic innervation of the thymus

doi: 10.1016/j.celrep.2026.117126

Figure Lengend Snippet: (A) Representative confocal z stack projection from highlighting the direct interaction of autofluorescent phagocytic-like cells in direct contact with along axons in an aged thymus. (B) Insert from (A) showing a group of phagocytic cells in direct contact with a dim β3-tubulin + axon bundle in the thymic parenchyma (white arrowheads). (C) Insert from (A) showing many phagocytic cells in direct contact with nerve bundles along a large CD31 + /CD144 + vein (white arrowheads). (D) Identification of large autofluorescent cells as macrophages by Iba1 labeling in a young thymus. (E) Image from an aged thymus demonstrating large hypertrophic Iba1 + macrophages. (F) Quantification of mRNA (2 ddCT ) for genes associated with cellular ROS production, inflammatory cytokines, and phagocytosis from sorted young adult and aged macrophages. Data are presented as mean ± standard error of the mean and analyzed with unpaired t test ( Nfe2l2 , Sod1 , Il1b , and Trem2 ), unpaired Welch’s t test ( Cybb , Cyba , Gpx1 , Prdx1 , Tnfa , Lamp1 , and Lamp2 ), or Mann-Whitney U test ( Apoe ); n = 10–12/group from 3 independent experiments. Scale bars: 50 μm in (A) and 35μm in (D) and (E).

Article Snippet: qPCR Primer – Apoe FW: GAACCGCTTCTGGGATTACCTG Rev: GCCTTTACTTCCGTCATAGTGTC , Origene , SKU: MP200816.

Techniques: Labeling, MANN-WHITNEY

Journal: Molecular neurodegeneration

Article Title: APOE Christchurch enhances a disease-associated microglial response to plaque but suppresses response to tau pathology.

doi: 10.1186/s13024-024-00793-x

Figure Lengend Snippet: Fig. 1 Generation of ApoeCh mouse model. a Partial amino acid (AA) sequence alignment between human and mouse APOE. The vertical blue arrow denotes the location of the R136S Christchurch variant (rs121918393), shown in red in the mouse ApoeCh sequence. Mouse has human APOE4 type sequence at positions 112 and 158 (underlined). AA differences between mouse and human APOE4 in this region are highlighted in yellow. In panels b, i, k, l and n, sex of individual animals are denoted by pink (female) or blue (male) circles. b Plasma cholesterol in 4 mo WT and ApoeCh HO mice (p = 0.0274). c, d Schematic showing mouse groups and study design of 5xFAD;ApoeCh (c) and PS19;ApoeCh (d) cohorts. e–f Apoe mRNA counts from single-cell spatial transcriptomics in the 5xFAD (e) and PS19 (f) cohorts. Each point represents one cell. g-h APOE protein mean fluorescence intensity (MFI) from single-cell spatial proteomics in the 5xFAD (g) and PS19 (h) cohorts. Each point represents one cell. i,l Quantification of APOE in soluble protein fraction from 5xFAD (i) and PS19 cohort animals (l) measured via ELISA, normalized to total protein concentration. j,m Dot blot analysis of APOE protein in insoluble protein fraction of 5xFAD (j) and PS19 (m) cohort. k,n Quantification of APOE protein in insoluble fraction 5xFAD (k) and PS19 (n) cohort normalized to sample brain weight. n = 2–3 mice/genotype for spatial proteomics. n = 3–6 mice/sex/genotype for cortical protein fractions. Data are represented as mean ± SEM. Two-way ANOVA followed by Tukey’s post hoc tests to examine biologically relevant interactions. Statistical significance is denoted by *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Article Snippet: Quantification of mouse APOE protein in soluble fraction were acquired using the Mouse Apolipoprotein E (APOE) ELISA Kit (EKN43629-96 T; Biomatik, Wilmington, Delaware,USA).

Techniques: Sequencing, Variant Assay, Clinical Proteomics, Fluorescence, Spatial Proteomics, Enzyme-linked Immunosorbent Assay, Protein Concentration, Dot Blot